Last week, while I was writing about the word that is the same in every language, (huh?), Marc was traveling back to Switzerland to confer with his PhD students and check in on our first-born. When he landed, he sent me an e-mail: “In Geneva waiting for the train for Morges…..all the usual emotions of coming back somehow…”

I asked him on skype later if he felt homesick. A little, he admitted. Well, we had lived in Switzerland for almost ten years, three years longer than any other place we’d lived before. I think I made a sympathetic noise. But I can’t really relate, because I’m not really homesick for Switzerland. I’m still enjoying shopping on Sunday and all these yoga classes. Continue reading

Moment of (unexpected) beauty

It was a long, wet winter here in Heidiland. And is has been a cold, soggy, hypothermia-inducing spring. Down in the Italian-speaking part of Switzerland, Lago Maggiore is brimming over. Around here the farmers can’t plant their potato crops, because the fields are too muddy for their tractors to till. Continue reading

More microbiome madness

All kinds of exciting things have been happening, and I haven’t written about any of them. Some of them involve running, and they will appear in the next post. This one is about my other current favorite topic, the human microbiome.

Last week The New York Times had two very interesting articles, one about eating the weeds in your backyard, and another about the human microbiome. The first one speaks for itself. Apparently eradication can be dropped in favor of ingestion. Maybe I’ll give it a try. In any case it eases my weed aversion just that much more. The second article covers research being done in association with the Human Microbiome Project. Here’s my favorite quote:

Dr. Barnett Kramer, director of the division of cancer prevention at the National Cancer Institute, who was not involved with the research project, had another image. Humans, he said, in some sense are made mostly of microbes. From the standpoint of our microbiome, he added, “we may just serve as packaging.” Continue reading

The garden again

It’s spring. The weeds are back in force. But somehow this year I just can’t get myself too riled up about them. It’s a combination of things:

  1. I’ve finally hired Oscar to deal with my garden overload. It came down to Oscar or tennis, and I chose Oscar. I look at the weeds and say “Oh, I must remember to tell Oscar to deal with that next time he comes.” Next time I see Oscar, though, he’s limping and I can’t understand his French any better than I did last time. I try to communicate about the weeds, but he’s obviously in pain and very busy so they remain. For the time being.
  2. I’ve decided that the horrible ones with the impossible-to-pull-out roots are hopeless. They win. I pull the stems off when I walk past them, and accept the fact that I will be doing this well into the autumn as they continue to grow back and get tougher.
  3. My weeds are nothing compared to these ones growing in the US that have Homeland Security’s knickers in a twist. The ones along the Texas-Mexico border are so big that whole communities of illegal aliens can hide in them for months at a time and no one will ever know they’re there. At least I don’t have to use a chainsaw to weed my garden. Puts things in perspective.
  4. I’d rather go running than work in the garden.

Continue reading

Space Invaders

Those who visit this space frequently know I have a thing about weeds (see my Weed Manifestos I and II). I like control and order, so these uninvited invaders offend my sense of decorum. I’m also lazy, which means I don’t want to do the actual physical labor involved in removing them. In short, I’m torn. Recently I lightened up a bit and decided to let them have their place in my garden. At least until Oscar comes and digs them all up.

Today, a whole bunch of things came together that made me think again about weeds – and more generally about what constitutes an “undesirable.” In a press release from the University of Arizona, I read this:

The recent field of invasion biology faces a new challenge as 19 eminent ecologists issue a call to “end the bias against non-native species” in the journal Nature.

The group is questioning the automatic (and politically correct) assumption that native species are inherently more valuable and “good” than non-native ones. It turns out that plants and critters brought in by accident in luggage or on purpose to eradicate a pest sometimes thrive so well in their new habitats that they crowd out the oldies. This causes consternation and a call to wipe out the newcomers, to put back the clock, to return nature to its “pristine” state. But as endless examples have shown, once these space invaders have gotten established, there is no going back. Just look at the cane toads in Australia, the zebra mussels in the Great Lakes and the Kudzu vine or Tamarisk in the Eastern US. Like it or not, they’re here to stay. 

Reading that paragraph over, it struck me that this isn’t just a problem with plants and animals. Here in Switzerland many people exhibit exactly this same bias against other, “invading” human populations. They don’t look right, smell right, eat the right things. They’re crowding us out of our jobs! They don’t share our ideas about what’s important! I think it’s actually a very human tendency – resistance to change. We often assume that how things were is automatically superior to how things are, particularly when newcomers are involved. 

But it’s certainly a selective resistance. As the press release mentioned, native species often do just as much, if not more damage than invaders. Nobody would mind at all if the bark beetles died out, gobbled up by, say, ladybugs from Outer Mongolia. I doubt anyone would fuss if the Anopheles Mosquito kicked up its heels and disappeared off the face of the Earth. Our outrage seems to be proportionally related to the cuteness of the local species and the ickiness of the invading one. Even our word choice screams bias — we employ the adjectives “invasive” and “non-native” much more frequently than “opportunistic” or “exotic” (this last is often used to refer to non-native plants sold in nurseries, however, which can be classified as attractive and thus are okay). 

Photo: katanski
In a remarkable coincidence, I came across an article in the New York Times about a cute little hamster living in the Alsace region of France that’s having a hard time surviving because the farmers have stopped planting alfalfa and are putting in corn or selling off their land for housing developments. These guys wake up after a winter of hibernation and there’s nothing to eat! There are only about 800 of them left in Alsace, although they’re apparently thriving in Eastern Europe and in no danger of extinction. The EU is planning to slap the French with up to   $25 million in fines if they don’t take measures to get the numbers up. 

Meanwhile, in Switzerland, the two wolves that are permitted to live in the Alps are under close scrutiny. They’d better behave themselves, because if they so much as show a whisker near a herd of sheep the hue and cry goes up and the guns come out. Livelihoods are at stake! This native species was eradicated ages ago long before anyone had written a thesis on “invasive species,” and nobody really wants them back, because the newcomers (people, sheep and cattle) aren’t interested in living in a balanced predator-prey ecosystem. The only predator here is the cheesemaker, the butcher and, eventually, the bank. (That’s Switzerland for you!) I guess their cuteness factor just doesn’t make the cut.

All this underscores a problem I’ve had with conservation biology (and now the new field, “Invasion Biology”) for a long time — that we’ve made the mistake of taking ourselves out of the equation. This is both mathematically and philosophically irresponsible. We don’t exist in parallel to nature, where one kind of reasoning applies to us, and another to the rest of the natural world. Our species is just another species, deeply interwoven with all the others, altering things irreversibly all the time, just like they are. 

I read today that every human parent passes 30 mutations on to his/her children. Like the rest of the natural world, we are in a state of constant adaptation. Nothing stays the same! We’re not going to stop traveling, so invaders will continue to invade. It doesn’t look like we’re going to stop heating up the planet, either, so habitats are going to change, making room for even more invaders. We’re invading each other, they’re invading us, we’re invading  them — it’s a war zone out there! So once again, I say, carpe diem, take a good look at what’s around you and savor it right now. It might be covered with Kudzu next week.

Come to think of it, isn’t there an argument that life on Earth originated from stuff that hitched a ride on a meteorite? Maybe the whole shebang we call “life” is one big massive accidental invasion. God is up there saying “now look what happened, I had a perfectly decent planet and now it’s crawling with vermin…”

Weed manifesto, part II

Since writing my Weed manifesto last month, I’ve been thinking a lot about my aversion to weeds. Every now and then, as I yank one up by the roots, I even feel a little twinge. Last week I had coffee at a friend’s house – a friend who has a perfect garden. I swear to you there was not a weed in sight. Neat mounded rows of lettuce, protected from the birds by clever chicken-wire covers, a stunning bed of irises, the trunk of the cherry tree neatly wrapped in anti-ant tape, pine boughs carefully placed under the blueberries. Little strawberry plants were artfully arranged under the apple tree. Aphid-free roses, their healthy leaves shining a deep, rich green, were setting the first buds of the season.

“She has such a great garden,” I said wisfully to my neighbor in the car afterwards. “Did you see any weeds? I didn’t.”

“Yeah, and her husband is also Swiss-German,” my friend said. “That’s her garden. Yours is yours.”

Wow. You mean there is no universal horticultural reference point? No ideal garden up there sitting next to the other Platonic forms like truth, beauty and justice? 

“You should stop stressing so much about your garden. It’s great just the way it is! Just get Oscar to come and deal with the weeds if you don’t want to. Life is short.”

This is my neighbor who can go to the nursery and come back with the perfect plant, the one whose garden is a lovely riot of color with very little apparent effort. But I pulled my nose out of my navel and grudgingly admitted that she had a point. I need less stress in my life, not more. Why should my garden be a source of stress? That’s just stupid. My life (and my garden and my garden-impaired non-Swiss-German husband) is mine, and I should embrace it as it is. 

As if to prove the point, guess who was in her driveway when we arrived? 


Now, Oscar is a character. He’s a native of Portugal who is employed as a handyman/gardener/concierge for a few big apartment buildings in our village. On the side, he tackles various private gardens. He works for a whole season without asking for a cent, and then bills you sometime in the middle of the winter for the whole shebang. It’s all meticulously itemized. I first heard about him from a Swedish woman whose lawn he rescued from the brink of death. I hired him to mow our lawn in the years before I would let Brendan do it (I was scared he’d run over his toes). He still prunes our trees because I am convinced that if I take shears to them, I will kill them all. I told my neighbor about him, and she referred him to someone else. Oscar has an unflappable work ethic and an accent so thick I can only understand about a third of the words that come out of his mouth. I think he’s speaking French — but the syntax and grammar are not entirely recognizable. I usually nod my head a lot when he talks and say repeatedly, “You’re the expert, Oscar, just do what you think needs doing.”

Oscar launched into an unintelligible diatribe about the new double-bladed lawn mower he had invested in and the flies along the lake, the relationship between which I failed to grasp completely. I managed to communicate that I’d like him to come sometime soon and deal with the majority of my weeds for me. 

There. It was that simple. 

He hasn’t showed yet, but I have totally let go of my weed stress. I’ve actually even started going in the opposite direction. Along with everything else in the garden, the weeds are blooming now. Some of them are really quite beautiful. What did they ever do to me, other than challenge my need for control? I decided to make room for some of them, to let a little chaos into my garden. The pictures in this post are all of weeds. In the name of diversity, openness, and yes, to claim my own garden as my own — here they are in all their glory.

This is the one that is so hard to pull out. If you squeeze the flower, it goes ‘pop’.

Odds and Ends

Just a quickie update on THREE things today:

FIRST, as I anticipated, my brother Dave cracked the Venter code. Actually, within minutes of reading my post, at 12:34 am his time, he was trying to explain it to me in a gmail chat.

Dave: You’re not going to believe this, but I already had a program that would decode it.
Me: No way.
Dave: Yep. A geocache puzzle was based on it so I added it to my code last summer. So for example: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA decodes to: LTS*CRAIGVENTERLTS* (LTS* means letters)

Right. That’s SO obvious. Then a minute later, he writes:

Dave: Ok, I found the watermarks here (link to the PDF of Venter’s paper in Science magazine with pages of incomprehensible (to me) gibberish).

A couple of minutes pass…

Dave: Hmm… My table is only partly right.
Dave: Hmm… well, I will write a decoder tomorrow.
Me: get on it, willya? 😉

Last night he told me he had figured out the code. 

Me: Are you getting ready to do your guest post?
Dave: Yes I might write it tonight. Should I post Python code?
Me: up to you. Preferably English. We don’t want to lose my loyal masses you know. All 25 of them.
Dave: Haha. OK, maybe I’ll write it tonight.

This morning, (midnight his time), he writes:

Dave: OK I got the Venter decoder working. It decoded them all perfectly. Only issue now is how to write the article.

So prepare yourselves. Dave is going to reveal how he cracked the Venter code. This is going to be an internet scoop, so tell all your friends about it.


Thanks to Brendan’s iPod adventure, I learned a valuable lesson about importing things into Switzerland today. In fact, I think I may have gained real insight into the economic protectionism that characterizes this itty bitty but ever so expensive country.

Thinking it would be complicated if not impossible to find a 5th generation nano in Switzerland, (the wee beastie is not sold in stores anymore), I ordered a nice green specimen on EBay while I was in the US. Dave then shipped it out to me, declaring a $200 value on the customs tag. We Americans tell the truth! To my surprise, I was required to pay nearly $60 to pick up the package from the Post Office. No money, no iPod.

I raged all the way home. It’s a miracle I didn’t get into an accident. My head very nearly exploded. I immediately called up those responsible. They informed me that once the value exceeds 100 francs, you have to pay VAT, even if it’s a gift from a beloved uncle. On top of that, they charge a flat 35 franc fee to process the package. What? I said. That’s outrageous!  The man explained that a lot of work was involved, and they had to recuperate costs.  If that’s the case, then these people are getting paid something like $300 an hour to rip packages open and then tape IOUs to them. Sounds peachy. Where can I sign up?

*** THIRD THING *** 

I did a post a little while ago about titles. Perusing Newswise recently, I came across two that riveted my attention, for different reasons. The first:

Sniffing Out Leukemia by Turning Dogs into Humans

Researchers at North Carolina State University are narrowing the search for genes involved in non-Hodgkin lymphoma – by turning dogs into humans.

Now that is really something! Has North Carolina State become Hogwarts? Why have a baby when you can turn the family dog into a human? No, really, if there was a contest for the worst and most misleading title+lead sentence of all time, I’d probably nominate this one. I did read far enough to understand that the research here was on the genetic level, not the organism level. No dogs became humans. Nobody is finding leukemia with an actual nose here. If you want to learn more, you’re welcome to follow this link.

Then yesterday, I saw this:
Breast Fat Injection Causes Confusion on Mammograms

Intrigued, I read the lead:

A breast augmentation procedure in which fat from other parts of the body is transferred to the breasts causes can cause false suspicion of breast cancer on follow-up mammograms, according to a study in the April issue of Plastic and Reconstructive Surgery®, the official medical journal of the American Society of Plastic Surgeons (ASPS).

Whoa!  Full stop! Do you mean to tell me that fat from other parts of my body – i.e. hips and thighs – could have been relocated to my breasts? THAT is a win-win if I’ve ever heard of one! Why didn’t anyone tell me about this? On second thought, back in my twenties, when it might have been interesting, I didn’t have that much fat on other parts of my body.

It’s just as well, because it turns out that the fat cells die, making them look suspiciously like tumors. The controversy here is that some radiologists say they can tell the difference, while others say they have to do biopsies just to be sure. I wonder which ones haven’t paid off their equipment yet?


Okay, I know I said three things, but I can’t leave this out. You’ll be happy to hear that blogging is improving my life. My husband Marc read about my weed distress and he actually agreed to help me rid the vegetable garden of its winter weed occupants. This is nothing short of a breakthrough!

There’s the evidence.

Weed Manifesto

No, not that kind of weed. Sorry, people. This is a gardening post.

Spring has come three weeks early to Switzerland. It’s 24 degrees (that’s 75 to you Americans), everything is bursting into bloom, the birds are singing their heads off at 4 am. The sound of the lawn mower can be heard throughout the land. Unless it’s lunch time or after six pm. Or Sunday. This is Switzerland, after all. There are rules to follow. Continue reading

Garden Delights

The daffodils are out this week. Spring is officially here. Never mind the groundhog (probably took one look and said “Okay, bad dream, back to bed.”). When the daffodils bloom it’s time to put the skis away and start buying tulips for the coffee table.

Tip: if you put a penny in the vase, the tulips won’t wilt.

I have a bit of a fraught relationship with the plant world. My mother and my sister are plant fanatics – on family hikes they’d constantly be stopping to identify flowers. If you saw an orchid, the day was made. My sister has since made a fantastic career out of the activity, traipsing around in jungles and deserts and swamps in search of stuff that nobody has named yet and getting it on the books before it’s too late. She’s amazing. We’ll be on a walk somewhere, and she’ll suddenly screech and bend down and dig out some tiny miniscule clump of moss or something and say, “Look! Microlittleus mossiporous! I haven’t seen this since 1986 on my trip to eastern Timbuktu!” while prying the poor little thing’s innards apart and examining them avidly. No, you can’t just walk from point A to point B with these types. The ground is literally covered with distractions.

As a teenager, I wanted nothing to do with this, naturally. I decided that it wasn’t the name of the thing that was important, or how rare it was, but how it made me feel. Why should I appreciate an orchid more than skunk cabbage? Wasn’t that a form of prejudice? Skunk cabbage is elegant! Just because something is rare doesn’t make it better, does it? Why is a pigeon a nuisance and a peregrine falcon a wonder? Both poop on city window ledges. I felt that looking at individual flowers and classing them away into neat categories missed the big picture, somehow. Of course, I probably just wanted to hike without having to stop every ten feet and hear “Oh! Look! Spotted mugwort!” “Umm, I’m not sure. See this leaf? It could be spotted hareweed. We should check. Get the book – right hand pocket –“

Come to think of it, I wonder if my decision to major in philosophy in college might not have originated in this adolescent fulmination against arranging nature into neatly-labeled categories.

Clearly, if there was a family plant-appreciation gene, I didn’t inherit it. There are a few varieties that I manage to keep from killing – they’re the ones labeled “hardy” at the nursery. The poor plant in our study has been dead for at least a year. It stays there, listing gently to one side, a constant reminder to me to water the other, luckier specimens downstairs.

I didn’t compensate for my botanical deficiencies through marriage, either. My husband’s idea of gardening is opening the phone book to “landscaping”. “We need to keep the economy moving, Mary,” he’ll say. He’s one of the only people I know who can make shirking a job look like public service.

When we moved into our house three years ago and had to plan a garden from scratch, I wanted a garden that took care of itself. The landscapers put loads of little baby plants in, promising me they’d cover the ground eventually, and then left. I spent the next two years in an all-out war with the hordes of weeds that invaded my vulnerable little plantings. The first two tons of weeds were kind of rewarding. I’d yank the things out by the roots, pleased with myself for knowing what was a weed and what wasn’t, pile them in the car and haul them out to the village dump. But soon every time I went out the front door I’d see weeds. Everywhere. There is one kind that won’t pull out. It breaks off at the base, leaving the roots to sprout new leaves. It drives me mad. I’ll be going out for a jog, and I won’t get past the driveway. I go back for a trowel, just to get that one weed. Then I see another. Then another. Pretty soon there’s a pile two feet wide on the driveway and I have a killer backache. I have to go in and get a beer and recuperate.

Two years ago, I decided that we needed a vegetable garden. I hired a gardener to pile up a bunch of dirt on a patch of grass, and planted carrots, lettuce, arugula, zucchini, tomatoes, and snowpeas. I bought a cheap compost bin and put it next to the garden. This was good! I was growing food! I could be a gardener. We would have juicy, red tomatoes, fresh lettuce from the garden in the evenings, zucchini, it would all be so healthy and so free. (Even after six years here, I still reel at the prices in the Swiss supermarkets.)

Nobody else showed the least interest in either the garden or the vegetables. When I came home after a visit to the US, the beautiful little cherry tomatoes were rotting on the vines, their poor stems choked with weeds, the snowpeas dessicated and crumbling, the lettuce sporting very unlettucy-looking flower stalks, the leaves all gone leathery and tough. The zucchini was the size of my lower leg.

Oddly enough, I couldn’t bring myself to care that much. I took a picture of Luc holding the gargantuan zucchini and then did damage control. I didn’t reproach them. I honestly think they don’t even see the garden. It just doesn’t register. Last summer I managed to get Brendan to mow the lawn in exchange for money. But for the most part, it’s just me versus the garden.

My neighbor makes it all look so effortless. She has planted her garden without the help of landscapers, bit by bit, as she has been inspired. Tons of amazing flowers bloom all the time. She has raspberries. Rosemary. Sage. It’s all so beautiful. She can go to the nursery and come home with just the right plant, put it in just the right place, and it will thrive. She can be gone for weeks at a time in the summer, and the garden looks just fine. I go to the nursery, wander the aisles, get overwhelmed with the possibilities, unable to picture anything at all in my own garden, leave with a packet of basil seeds (thinking about pesto), go home and curl up on the couch with a book. I leave for three days and weeds the size of baby redwoods sprout on the south-facing slope.

Oscar came today, to do a little spring pruning. I am amazed at how hardy these plants are. We didn’t have much of a winter this year, but we had some good snowfalls in December and many days below freezing. Nonetheless, the parsley is thriving and the lavender along the street is looking like it will survive, even though I pruned it way too late last summer. The garden looks like it might forgive me, once again, for my ignorance and ineptitude.

The daffodils, bless them, come up every year, no matter what I do. They’re the best part of the garden – the miracle of matter from nothing but sunlight and water, the promise of warmth and color and beauty – and most importantly, there’s as yet no indication of the weeds and chaos that will take over the garden (and my psyche) in the weeks to come. Time to gear up for another season of gardening!