Jan 292013
 
Dispatch from the pit

It happened today. Out running along the lake in a cold drizzle, I felt it. The low pit of winter is past. We’re on the upslope to spring. There was a huge gaggle of cormorants (is gaggle the right term for cormorants?) on the fake island in Preverenges. They must be on their way to Scandinavia. They must be feeling it, too. (I took this picture the day before.) I know it officially happened on December 21, when the balance of dark versus light hit bottom and the slow climb back into the sun began once again. But January is usually still too dark and cold and, well, winter for it to register. Today, however, despite the clouds and the rain, I finally feel like I’m climbing out of the hole.

Nov 272012
 
You want fries with that?

Gydle has been silent the entire month of November. No excuses, I just didn’t have anything to say. Then I woke up this morning and my brain was teeming with ideas. Was it something I ate? First, I have a great gift idea. I got an e-mail the other day from “American Gut.” Imagine my excitement! The Human Food Project is live on IndieGoGo. For only $99 and a stool sample, you can get a list of the microbes colonizing your gut. Upscaling is a bargain – it’s $180 for two samples, $260 for three and a mere $320 for a family of four!

Sep 062012
 
Holy hairballs, Batman! It's not junk after all!

Greetings from hibernation nation. I did say I’d come out if something really big happened. Guess what? One of my current scientific obsessions was Big News today! No, don’t go away – it’s not the microbiome. It’s my other obsession: junk DNA. I’ve written about it before, here and here and here. In a stunning “no doh?” development, a vast international array of researchers has discovered that the 99% of the human genome that was considered “useless junk” isn’t junk after all.

Nov 132011
 
Spiraling down the double helix

It’s almost mid-month.  I’m at about 19,000 words, about 3,000 words behind my carefully calculated NaNoWriMo goal. (I’ve made an excel spreadsheet). I took my blood pressure yesterday and realized that stressing about keeping up with my self-imposed word count is not helping anything. In fact, my scientific approach to this endeavor – just 2,000 words a day, gives me 5 days off – is totally ludicrous. Creativity doesn’t work like that. I should know better. Take yesterday. The central theme of my plot involves people researching induced pluripotent stem cells. Informing myself on this seemed the sensible thing to do, so I started reading. Now, I don’t know about you, but it seems to me that the topic of stem cells has been around forever. But did you know that human embryonic stem cells were only discovered in 1998? We’ve only known about these suckers for a dozen years? click here to read the whole dang post [...]

Apr 142011
 
Watermarks

I’m not all that thrilled that my first post here is a techie one. I was kind of hoping I could write about flowers or something. But Mary was so impressed by my decoding skills that she prevailed upon me to write this. So blame her. Here is a picture of flowers anyway. For the record, my decoding skills are OK, but not great. I am mostly pretty good at it because I am so lazy. I’ll write more about that later. In this post, I will describe how to figure out the encoding scheme for the DNA watermarks Mary described in her recent post. My main goal is to give an example of how a code gets deciphered. It’s an art as well as a science. This particular code is not insanely difficult, so it makes a good example. On to the watermarks. I got the watermarks themselves from click here to read the whole dang post [...]

Apr 132011
 
Odds and Ends

Just a quickie update on THREE things today: FIRST, as I anticipated, my brother Dave cracked the Venter code. Actually, within minutes of reading my post, at 12:34 am his time, he was trying to explain it to me in a gmail chat. Dave: You’re not going to believe this, but I already had a program that would decode it. Me: No way. Dave: Yep. A geocache puzzle was based on it so I added it to my code last summer. So for example: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA decodes to: LTS*CRAIGVENTERLTS* (LTS* means letters) Right. That’s SO obvious. Then a minute later, he writes: Dave: Ok, I found the watermarks here (link to the PDF of Venter’s paper in Science magazine with pages of incomprehensible (to me) gibberish). A couple of minutes pass… Dave: Hmm… My table is only partly right. Dave: Hmm… well, I will write a decoder tomorrow. Me: get on click here to read the whole dang post [...]

Apr 112011
 
Designer DNA Dinged

Who says scientists and writers can’t play God? My sister recently alerted me to a story in which science and literature intersect in a very bizarre way. It’s weird enough that I thought I’d pass it on. A little less than a year ago, maverick geneticist (and yacht owner) Craig Venter rocked the world (again) by announcing that he had created synthetic life. His team had developed a bacterial-like genome from DNA made in the laboratory. First, they ordered DNA pieces 1,000 units in length from a company called Blue Heron that specializes in synthesizing DNA. Then they used some helpful yeasts to weave it together (the first microbial sweatshop?). Finally, they put this new synthetic genome into a cell whose genetic material had been removed. The new DNA took over the cell and promptly started manufacturing its own proteins, rather than the proteins the original cell would have made. click here to read the whole dang post [...]