I’m not all that thrilled that my first post here is a techie one. I was kind of hoping I could write about flowers or something. But Mary was so impressed by my decoding skills that she prevailed upon me to write this. So blame her. Here is a picture of flowers anyway. For the record, my decoding skills are OK, but not great. I am mostly pretty good at it because I am so lazy. I’ll write more about that later. In this post, I will describe how to figure out the encoding scheme for the DNA watermarks Mary described in her recent post. My main goal is to give an example of how a code gets deciphered. It’s an art as well as a science. This particular code is not insanely difficult, so it makes a good example. On to the watermarks. I got the watermarks themselves from click here to read the whole dang post [...]
Just a quickie update on THREE things today: FIRST, as I anticipated, my brother Dave cracked the Venter code. Actually, within minutes of reading my post, at 12:34 am his time, he was trying to explain it to me in a gmail chat. Dave: You’re not going to believe this, but I already had a program that would decode it. Me: No way. Dave: Yep. A geocache puzzle was based on it so I added it to my code last summer. So for example: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA decodes to: LTS*CRAIGVENTERLTS* (LTS* means letters) Right. That’s SO obvious. Then a minute later, he writes: Dave: Ok, I found the watermarks here (link to the PDF of Venter’s paper in Science magazine with pages of incomprehensible (to me) gibberish). A couple of minutes pass… Dave: Hmm… My table is only partly right. Dave: Hmm… well, I will write a decoder tomorrow. Me: get on click here to read the whole dang post [...]
Who says scientists and writers can’t play God? My sister recently alerted me to a story in which science and literature intersect in a very bizarre way. It’s weird enough that I thought I’d pass it on. A little less than a year ago, maverick geneticist (and yacht owner) Craig Venter rocked the world (again) by announcing that he had created synthetic life. His team had developed a bacterial-like genome from DNA made in the laboratory. First, they ordered DNA pieces 1,000 units in length from a company called Blue Heron that specializes in synthesizing DNA. Then they used some helpful yeasts to weave it together (the first microbial sweatshop?). Finally, they put this new synthetic genome into a cell whose genetic material had been removed. The new DNA took over the cell and promptly started manufacturing its own proteins, rather than the proteins the original cell would have made. click here to read the whole dang post [...]
