Home

Last week, while I was writing about the word that is the same in every language, (huh?), Marc was traveling back to Switzerland to confer with his PhD students and check in on our first-born. When he landed, he sent me an e-mail: “In Geneva waiting for the train for Morges…..all the usual emotions of coming back somehow…”

I asked him on skype later if he felt homesick. A little, he admitted. Well, we had lived in Switzerland for almost ten years, three years longer than any other place we’d lived before. I think I made a sympathetic noise. But I can’t really relate, because I’m not really homesick for Switzerland. I’m still enjoying shopping on Sunday and all these yoga classes. Continue reading

Last lines to Lausanne

IMG_2781My last days living in Switzerland are looming. Two weeks and I’ll be back across the pond, the sun rising hours later on a completely different body of water. As the time draws nearer, I realize that:

One, I’m getting really impatient with things that drive me nuts about Switzerland.

Two, I’m already feeling nostalgic about the things that I love about Switzerland. Continue reading

The garden again

It’s spring. The weeds are back in force. But somehow this year I just can’t get myself too riled up about them. It’s a combination of things:

  1. I’ve finally hired Oscar to deal with my garden overload. It came down to Oscar or tennis, and I chose Oscar. I look at the weeds and say “Oh, I must remember to tell Oscar to deal with that next time he comes.” Next time I see Oscar, though, he’s limping and I can’t understand his French any better than I did last time. I try to communicate about the weeds, but he’s obviously in pain and very busy so they remain. For the time being.
  2. I’ve decided that the horrible ones with the impossible-to-pull-out roots are hopeless. They win. I pull the stems off when I walk past them, and accept the fact that I will be doing this well into the autumn as they continue to grow back and get tougher.
  3. My weeds are nothing compared to these ones growing in the US that have Homeland Security’s knickers in a twist. The ones along the Texas-Mexico border are so big that whole communities of illegal aliens can hide in them for months at a time and no one will ever know they’re there. At least I don’t have to use a chainsaw to weed my garden. Puts things in perspective.
  4. I’d rather go running than work in the garden.

Continue reading

Tidying up

This is going to be an odds and ends post. I have left many things dangling in this blog. Time to clean up.

Disorganization in general is starting to make me crazy. I can’t sit down to work any more if the kitchen counter is cluttered, or if my bed, out of sight upstairs, remains unmade. It’s not a writer’s block-related avoidance thing. More often than not, I’m eager to get to work. No, I am deeply afraid this is genetic.

My dear mom is the kind that makes you clean your room before the cleaning lady comes, so she doesn’t waste her time picking up your mess. You want to make cookies? Fine, but the kitchen better be spotless when you’re done. She has a deep obsession with kitchen counters, or perhaps horizontal surfaces in general – they must remain clutter-free or her karma is just off. And trust me, a karma-skewed mom is a thing to avoid.

The upside of this is that she knows exactly where everything is. She is so sublimely well-organized that when I was there this spring she was able to direct me to the exact part of the exact shelf in the exact basement cupboard where the spare wheels to the desk chair in the study were kept. If it had been my desk chair, I’d have either thrown the spare wheels out or tossed them into a box and promptly forgotten about them. If I subsequently found I needed a desk chair with wheels, I would probably have gone and bought a new chair rather than figure out where they were (or weren’t).

I am not sure why this neatness urge is manifesting in my life at this point, but there you have it. Time to tidy up the blog.

First, the Deepwater Horizon oil spill thing. I promised I’d share the news about the discovery, the details of which had been carefully written down in a set of notes that I lost. I never did find the notes. But the scientist’s article finally got published, and EPFL wrote a press release. The article I wrote has also been published, but unfortunately it’s not online yet. I’ll put a link here when it comes up. Bottom line: nasty stuff that normally evaporates in surface spills got stuck in a huge plume 1000m below the surface, which spread out over a vast area. This was the first deep-water spill ever, so nobody knew what would happen to the chemicals as they rose up through the water column. Now they know. So do the fishes and other critters of the Gulf, even though they don’t read PNAS.

Second, my blood pressure has mysteriously normalized. I went to Walgreen’s when I was in New Mexico this summer and bought a blood pressure monitor, so I wouldn’t have to keep going up to the village pharmacy to get it checked. I was beginning to worry that they thought I was a hypochondriac. The pharmacist is a fellow violist, and every time I went in I could count on a half-hour discussion about the Geneva chamber orchestra, in which he would renew his campaign to get me to play in the viola section again – just one more concert (we’re playing Beethoven!). Now I can track my very own data in the comfort of my living room and avoid commitment at the same time! I’ll probably make a graph for my October doctor’s appointment. I have no idea why it went down. I suspect it may be correlated with a jelly-belly-overdose-induced decision to cut back on my sugar intake.

Third, my garden survived. I think it even paid for itself in vegetables. The carrots, peppers, zucchini and tomatoes thrived (throve?). All that remains are the indomitable zucchini plants, some basil and the tomatoes, whose leaves all look sick and splotchy. The lettuce, arugula and spinach were a fail; something came in the night and devoured everything. A little pumpkin-like squash reached about 3″ in diameter and then abruptly stopped growing. Two or three little cukes similarly gave up the ghost prematurely. Considering my level of competence and my overall expectations, I’m calling the whole thing a success. On the weed front, I have maintained my new philosophy to live and let live. I pull out the worst offenders, but it is no longer war. The yard is also maturing, so the plants that are supposed to be there are getting better at asserting themselves. I find I need to intervene less frequently. Walk away, Mary, just walk away. A great lesson for the mother of two teenagers…

One last thing. This week I’ve been working quite hard – tons of actual paid work, and also a potential guest post on another person’s blog. Yes, I might become famous! No, not really, but it was an opportunity to write about a subject that I haven’t yet treated in this spot – running – and I couldn’t resist. If it gets accepted, I’ll put up a special post with just a link to that other blog. I’ll expect you all to go rushing over there to read it and comment on what a great guest post it is. Like “Amazing post. How did you find this fabulous writer?” Please?

If it doesn’t get accepted, I’ll post it here, and you can all read it anyway.

The Bounty

The fire appears to have spared the town of Los Alamos, but it continues to spread, and has officially become the largest forest fire in New Mexico history. It’s still only 5% contained and is now decimating the sacred lands of the Santa Clara pueblo. My classmate Joe became something of a local celebrity for his efforts to keep people informed via Facebook. He was on the local news at least twice, once playing his electric guitar


Social media are changing the way we experience events like this. It has been fascinating to sit in on these exchanges and participate in the conversation. More than 3,700 people have joined the Friends of the LA Fire Facebook page (I don’t think any of us are feeling friendly towards the fire, but that was the name chosen), where the sense of community is palpable. Requests for donations, updates on the fire situation, posts by experts and reports from community meetings — and the occasional joke like this one, a reply to a post entitled “In Los Alamos…”


You know you’re from Los Alamos when you bring a friend home from college and when he asks how the microwave works, he gets a lecture from your dad about how microwaves work rather than instructions on how to operate it.


In Los Alamos, kids don’t need night lights. They ARE night lights.


The post has 224 replies so far! No lack of fuel for this particular fire.




In the meantime…


My garden has gone into production! 


Something ate all the lettuce and spinach pretty much the moment they poked their little leaves out of the soil. I suspect snails, but I haven’t caught any in the act. At least they’re getting their vegetables. 


Everything else is thriving. The arugula went from seedling to seed in about five minutes, and by the time I thought to pluck some for my salad it was way too bitter. It’s really easy and rewarding to yank the plants out of the ground, though. Très therapeutic. 


I’m pinching back the exuberant tomatoes before they get totally out of control like they did last year. I’m thinning out the carrots. It goes against all my instincts to pull out something that’s potentially edible, but I hardened myself and did it anyway. Now the lucky chosen ones can breathe. A lot of innocent baby carrots were sacrificed for that to happen. I hope they appreciate it.


So far, everything I’ve harvested has been green:

El diablo
The Schnozz
The happy farmer
Mr. Miserable

I would have taken more pictures, but sugar snap peas are one of my favorite foods (after jelly bellies) and I started eating them, thus drastically reducing the artistic possibilities. I’m looking forward to an enhanced color palette once the carrots, tomatoes, red peppers and eggplant ripen. 


A note on fireworks for this Fourth of July: why not just skip them? They scare animals, blind and dismember overenthusiastic pyromaniacs, and cause forest fires. The night sky is a pretty awesome show in itself, and it doesn’t hurt your ears.

Space Invaders

Those who visit this space frequently know I have a thing about weeds (see my Weed Manifestos I and II). I like control and order, so these uninvited invaders offend my sense of decorum. I’m also lazy, which means I don’t want to do the actual physical labor involved in removing them. In short, I’m torn. Recently I lightened up a bit and decided to let them have their place in my garden. At least until Oscar comes and digs them all up.

Today, a whole bunch of things came together that made me think again about weeds – and more generally about what constitutes an “undesirable.” In a press release from the University of Arizona, I read this:

The recent field of invasion biology faces a new challenge as 19 eminent ecologists issue a call to “end the bias against non-native species” in the journal Nature.

The group is questioning the automatic (and politically correct) assumption that native species are inherently more valuable and “good” than non-native ones. It turns out that plants and critters brought in by accident in luggage or on purpose to eradicate a pest sometimes thrive so well in their new habitats that they crowd out the oldies. This causes consternation and a call to wipe out the newcomers, to put back the clock, to return nature to its “pristine” state. But as endless examples have shown, once these space invaders have gotten established, there is no going back. Just look at the cane toads in Australia, the zebra mussels in the Great Lakes and the Kudzu vine or Tamarisk in the Eastern US. Like it or not, they’re here to stay. 

Reading that paragraph over, it struck me that this isn’t just a problem with plants and animals. Here in Switzerland many people exhibit exactly this same bias against other, “invading” human populations. They don’t look right, smell right, eat the right things. They’re crowding us out of our jobs! They don’t share our ideas about what’s important! I think it’s actually a very human tendency – resistance to change. We often assume that how things were is automatically superior to how things are, particularly when newcomers are involved. 

But it’s certainly a selective resistance. As the press release mentioned, native species often do just as much, if not more damage than invaders. Nobody would mind at all if the bark beetles died out, gobbled up by, say, ladybugs from Outer Mongolia. I doubt anyone would fuss if the Anopheles Mosquito kicked up its heels and disappeared off the face of the Earth. Our outrage seems to be proportionally related to the cuteness of the local species and the ickiness of the invading one. Even our word choice screams bias — we employ the adjectives “invasive” and “non-native” much more frequently than “opportunistic” or “exotic” (this last is often used to refer to non-native plants sold in nurseries, however, which can be classified as attractive and thus are okay). 

Photo: katanski
In a remarkable coincidence, I came across an article in the New York Times about a cute little hamster living in the Alsace region of France that’s having a hard time surviving because the farmers have stopped planting alfalfa and are putting in corn or selling off their land for housing developments. These guys wake up after a winter of hibernation and there’s nothing to eat! There are only about 800 of them left in Alsace, although they’re apparently thriving in Eastern Europe and in no danger of extinction. The EU is planning to slap the French with up to   $25 million in fines if they don’t take measures to get the numbers up. 

Meanwhile, in Switzerland, the two wolves that are permitted to live in the Alps are under close scrutiny. They’d better behave themselves, because if they so much as show a whisker near a herd of sheep the hue and cry goes up and the guns come out. Livelihoods are at stake! This native species was eradicated ages ago long before anyone had written a thesis on “invasive species,” and nobody really wants them back, because the newcomers (people, sheep and cattle) aren’t interested in living in a balanced predator-prey ecosystem. The only predator here is the cheesemaker, the butcher and, eventually, the bank. (That’s Switzerland for you!) I guess their cuteness factor just doesn’t make the cut.

All this underscores a problem I’ve had with conservation biology (and now the new field, “Invasion Biology”) for a long time — that we’ve made the mistake of taking ourselves out of the equation. This is both mathematically and philosophically irresponsible. We don’t exist in parallel to nature, where one kind of reasoning applies to us, and another to the rest of the natural world. Our species is just another species, deeply interwoven with all the others, altering things irreversibly all the time, just like they are. 

I read today that every human parent passes 30 mutations on to his/her children. Like the rest of the natural world, we are in a state of constant adaptation. Nothing stays the same! We’re not going to stop traveling, so invaders will continue to invade. It doesn’t look like we’re going to stop heating up the planet, either, so habitats are going to change, making room for even more invaders. We’re invading each other, they’re invading us, we’re invading  them — it’s a war zone out there! So once again, I say, carpe diem, take a good look at what’s around you and savor it right now. It might be covered with Kudzu next week.

Come to think of it, isn’t there an argument that life on Earth originated from stuff that hitched a ride on a meteorite? Maybe the whole shebang we call “life” is one big massive accidental invasion. God is up there saying “now look what happened, I had a perfectly decent planet and now it’s crawling with vermin…”

Weed manifesto, part II

Since writing my Weed manifesto last month, I’ve been thinking a lot about my aversion to weeds. Every now and then, as I yank one up by the roots, I even feel a little twinge. Last week I had coffee at a friend’s house – a friend who has a perfect garden. I swear to you there was not a weed in sight. Neat mounded rows of lettuce, protected from the birds by clever chicken-wire covers, a stunning bed of irises, the trunk of the cherry tree neatly wrapped in anti-ant tape, pine boughs carefully placed under the blueberries. Little strawberry plants were artfully arranged under the apple tree. Aphid-free roses, their healthy leaves shining a deep, rich green, were setting the first buds of the season.


“She has such a great garden,” I said wisfully to my neighbor in the car afterwards. “Did you see any weeds? I didn’t.”

“Yeah, and her husband is also Swiss-German,” my friend said. “That’s her garden. Yours is yours.”

Wow. You mean there is no universal horticultural reference point? No ideal garden up there sitting next to the other Platonic forms like truth, beauty and justice? 

“You should stop stressing so much about your garden. It’s great just the way it is! Just get Oscar to come and deal with the weeds if you don’t want to. Life is short.”

This is my neighbor who can go to the nursery and come back with the perfect plant, the one whose garden is a lovely riot of color with very little apparent effort. But I pulled my nose out of my navel and grudgingly admitted that she had a point. I need less stress in my life, not more. Why should my garden be a source of stress? That’s just stupid. My life (and my garden and my garden-impaired non-Swiss-German husband) is mine, and I should embrace it as it is. 

As if to prove the point, guess who was in her driveway when we arrived? 

Oscar. 

Now, Oscar is a character. He’s a native of Portugal who is employed as a handyman/gardener/concierge for a few big apartment buildings in our village. On the side, he tackles various private gardens. He works for a whole season without asking for a cent, and then bills you sometime in the middle of the winter for the whole shebang. It’s all meticulously itemized. I first heard about him from a Swedish woman whose lawn he rescued from the brink of death. I hired him to mow our lawn in the years before I would let Brendan do it (I was scared he’d run over his toes). He still prunes our trees because I am convinced that if I take shears to them, I will kill them all. I told my neighbor about him, and she referred him to someone else. Oscar has an unflappable work ethic and an accent so thick I can only understand about a third of the words that come out of his mouth. I think he’s speaking French — but the syntax and grammar are not entirely recognizable. I usually nod my head a lot when he talks and say repeatedly, “You’re the expert, Oscar, just do what you think needs doing.”

Oscar launched into an unintelligible diatribe about the new double-bladed lawn mower he had invested in and the flies along the lake, the relationship between which I failed to grasp completely. I managed to communicate that I’d like him to come sometime soon and deal with the majority of my weeds for me. 

There. It was that simple. 

He hasn’t showed yet, but I have totally let go of my weed stress. I’ve actually even started going in the opposite direction. Along with everything else in the garden, the weeds are blooming now. Some of them are really quite beautiful. What did they ever do to me, other than challenge my need for control? I decided to make room for some of them, to let a little chaos into my garden. The pictures in this post are all of weeds. In the name of diversity, openness, and yes, to claim my own garden as my own — here they are in all their glory.






This is the one that is so hard to pull out. If you squeeze the flower, it goes ‘pop’.






Odds and Ends

Just a quickie update on THREE things today:

FIRST, as I anticipated, my brother Dave cracked the Venter code. Actually, within minutes of reading my post, at 12:34 am his time, he was trying to explain it to me in a gmail chat.

Dave: You’re not going to believe this, but I already had a program that would decode it.
Me: No way.
Dave: Yep. A geocache puzzle was based on it so I added it to my code last summer. So for example: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA decodes to: LTS*CRAIGVENTERLTS* (LTS* means letters)

Right. That’s SO obvious. Then a minute later, he writes:

Dave: Ok, I found the watermarks here (link to the PDF of Venter’s paper in Science magazine with pages of incomprehensible (to me) gibberish).

A couple of minutes pass…

Dave: Hmm… My table is only partly right.
Dave: Hmm… well, I will write a decoder tomorrow.
Me: get on it, willya? 😉

Last night he told me he had figured out the code. 

Me: Are you getting ready to do your guest post?
Dave: Yes I might write it tonight. Should I post Python code?
Me: up to you. Preferably English. We don’t want to lose my loyal masses you know. All 25 of them.
Dave: Haha. OK, maybe I’ll write it tonight.

This morning, (midnight his time), he writes:

Dave: OK I got the Venter decoder working. It decoded them all perfectly. Only issue now is how to write the article.

So prepare yourselves. Dave is going to reveal how he cracked the Venter code. This is going to be an internet scoop, so tell all your friends about it.

*** SECOND ITEM ***

Thanks to Brendan’s iPod adventure, I learned a valuable lesson about importing things into Switzerland today. In fact, I think I may have gained real insight into the economic protectionism that characterizes this itty bitty but ever so expensive country.

Thinking it would be complicated if not impossible to find a 5th generation nano in Switzerland, (the wee beastie is not sold in stores anymore), I ordered a nice green specimen on EBay while I was in the US. Dave then shipped it out to me, declaring a $200 value on the customs tag. We Americans tell the truth! To my surprise, I was required to pay nearly $60 to pick up the package from the Post Office. No money, no iPod.

I raged all the way home. It’s a miracle I didn’t get into an accident. My head very nearly exploded. I immediately called up those responsible. They informed me that once the value exceeds 100 francs, you have to pay VAT, even if it’s a gift from a beloved uncle. On top of that, they charge a flat 35 franc fee to process the package. What? I said. That’s outrageous!  The man explained that a lot of work was involved, and they had to recuperate costs.  If that’s the case, then these people are getting paid something like $300 an hour to rip packages open and then tape IOUs to them. Sounds peachy. Where can I sign up?

*** THIRD THING *** 

I did a post a little while ago about titles. Perusing Newswise recently, I came across two that riveted my attention, for different reasons. The first:

Sniffing Out Leukemia by Turning Dogs into Humans

Researchers at North Carolina State University are narrowing the search for genes involved in non-Hodgkin lymphoma – by turning dogs into humans.

Now that is really something! Has North Carolina State become Hogwarts? Why have a baby when you can turn the family dog into a human? No, really, if there was a contest for the worst and most misleading title+lead sentence of all time, I’d probably nominate this one. I did read far enough to understand that the research here was on the genetic level, not the organism level. No dogs became humans. Nobody is finding leukemia with an actual nose here. If you want to learn more, you’re welcome to follow this link.

Then yesterday, I saw this:
Breast Fat Injection Causes Confusion on Mammograms

Intrigued, I read the lead:

A breast augmentation procedure in which fat from other parts of the body is transferred to the breasts causes can cause false suspicion of breast cancer on follow-up mammograms, according to a study in the April issue of Plastic and Reconstructive Surgery®, the official medical journal of the American Society of Plastic Surgeons (ASPS).

Whoa!  Full stop! Do you mean to tell me that fat from other parts of my body – i.e. hips and thighs – could have been relocated to my breasts? THAT is a win-win if I’ve ever heard of one! Why didn’t anyone tell me about this? On second thought, back in my twenties, when it might have been interesting, I didn’t have that much fat on other parts of my body.

It’s just as well, because it turns out that the fat cells die, making them look suspiciously like tumors. The controversy here is that some radiologists say they can tell the difference, while others say they have to do biopsies just to be sure. I wonder which ones haven’t paid off their equipment yet?

*** NUMBER FOUR ***

Okay, I know I said three things, but I can’t leave this out. You’ll be happy to hear that blogging is improving my life. My husband Marc read about my weed distress and he actually agreed to help me rid the vegetable garden of its winter weed occupants. This is nothing short of a breakthrough!

There’s the evidence.

Weed Manifesto

No, not that kind of weed. Sorry, people. This is a gardening post.

Spring has come three weeks early to Switzerland. It’s 24 degrees (that’s 75 to you Americans), everything is bursting into bloom, the birds are singing their heads off at 4 am. The sound of the lawn mower can be heard throughout the land. Unless it’s lunch time or after six pm. Or Sunday. This is Switzerland, after all. There are rules to follow. Continue reading

Garden Delights

The daffodils are out this week. Spring is officially here. Never mind the groundhog (probably took one look and said “Okay, bad dream, back to bed.”). When the daffodils bloom it’s time to put the skis away and start buying tulips for the coffee table.

Tip: if you put a penny in the vase, the tulips won’t wilt.

I have a bit of a fraught relationship with the plant world. My mother and my sister are plant fanatics – on family hikes they’d constantly be stopping to identify flowers. If you saw an orchid, the day was made. My sister has since made a fantastic career out of the activity, traipsing around in jungles and deserts and swamps in search of stuff that nobody has named yet and getting it on the books before it’s too late. She’s amazing. We’ll be on a walk somewhere, and she’ll suddenly screech and bend down and dig out some tiny miniscule clump of moss or something and say, “Look! Microlittleus mossiporous! I haven’t seen this since 1986 on my trip to eastern Timbuktu!” while prying the poor little thing’s innards apart and examining them avidly. No, you can’t just walk from point A to point B with these types. The ground is literally covered with distractions.

As a teenager, I wanted nothing to do with this, naturally. I decided that it wasn’t the name of the thing that was important, or how rare it was, but how it made me feel. Why should I appreciate an orchid more than skunk cabbage? Wasn’t that a form of prejudice? Skunk cabbage is elegant! Just because something is rare doesn’t make it better, does it? Why is a pigeon a nuisance and a peregrine falcon a wonder? Both poop on city window ledges. I felt that looking at individual flowers and classing them away into neat categories missed the big picture, somehow. Of course, I probably just wanted to hike without having to stop every ten feet and hear “Oh! Look! Spotted mugwort!” “Umm, I’m not sure. See this leaf? It could be spotted hareweed. We should check. Get the book – right hand pocket –“

Come to think of it, I wonder if my decision to major in philosophy in college might not have originated in this adolescent fulmination against arranging nature into neatly-labeled categories.

Clearly, if there was a family plant-appreciation gene, I didn’t inherit it. There are a few varieties that I manage to keep from killing – they’re the ones labeled “hardy” at the nursery. The poor plant in our study has been dead for at least a year. It stays there, listing gently to one side, a constant reminder to me to water the other, luckier specimens downstairs.

I didn’t compensate for my botanical deficiencies through marriage, either. My husband’s idea of gardening is opening the phone book to “landscaping”. “We need to keep the economy moving, Mary,” he’ll say. He’s one of the only people I know who can make shirking a job look like public service.

When we moved into our house three years ago and had to plan a garden from scratch, I wanted a garden that took care of itself. The landscapers put loads of little baby plants in, promising me they’d cover the ground eventually, and then left. I spent the next two years in an all-out war with the hordes of weeds that invaded my vulnerable little plantings. The first two tons of weeds were kind of rewarding. I’d yank the things out by the roots, pleased with myself for knowing what was a weed and what wasn’t, pile them in the car and haul them out to the village dump. But soon every time I went out the front door I’d see weeds. Everywhere. There is one kind that won’t pull out. It breaks off at the base, leaving the roots to sprout new leaves. It drives me mad. I’ll be going out for a jog, and I won’t get past the driveway. I go back for a trowel, just to get that one weed. Then I see another. Then another. Pretty soon there’s a pile two feet wide on the driveway and I have a killer backache. I have to go in and get a beer and recuperate.

Two years ago, I decided that we needed a vegetable garden. I hired a gardener to pile up a bunch of dirt on a patch of grass, and planted carrots, lettuce, arugula, zucchini, tomatoes, and snowpeas. I bought a cheap compost bin and put it next to the garden. This was good! I was growing food! I could be a gardener. We would have juicy, red tomatoes, fresh lettuce from the garden in the evenings, zucchini, it would all be so healthy and so free. (Even after six years here, I still reel at the prices in the Swiss supermarkets.)

Nobody else showed the least interest in either the garden or the vegetables. When I came home after a visit to the US, the beautiful little cherry tomatoes were rotting on the vines, their poor stems choked with weeds, the snowpeas dessicated and crumbling, the lettuce sporting very unlettucy-looking flower stalks, the leaves all gone leathery and tough. The zucchini was the size of my lower leg.

Oddly enough, I couldn’t bring myself to care that much. I took a picture of Luc holding the gargantuan zucchini and then did damage control. I didn’t reproach them. I honestly think they don’t even see the garden. It just doesn’t register. Last summer I managed to get Brendan to mow the lawn in exchange for money. But for the most part, it’s just me versus the garden.

My neighbor makes it all look so effortless. She has planted her garden without the help of landscapers, bit by bit, as she has been inspired. Tons of amazing flowers bloom all the time. She has raspberries. Rosemary. Sage. It’s all so beautiful. She can go to the nursery and come home with just the right plant, put it in just the right place, and it will thrive. She can be gone for weeks at a time in the summer, and the garden looks just fine. I go to the nursery, wander the aisles, get overwhelmed with the possibilities, unable to picture anything at all in my own garden, leave with a packet of basil seeds (thinking about pesto), go home and curl up on the couch with a book. I leave for three days and weeds the size of baby redwoods sprout on the south-facing slope.

Oscar came today, to do a little spring pruning. I am amazed at how hardy these plants are. We didn’t have much of a winter this year, but we had some good snowfalls in December and many days below freezing. Nonetheless, the parsley is thriving and the lavender along the street is looking like it will survive, even though I pruned it way too late last summer. The garden looks like it might forgive me, once again, for my ignorance and ineptitude.

The daffodils, bless them, come up every year, no matter what I do. They’re the best part of the garden – the miracle of matter from nothing but sunlight and water, the promise of warmth and color and beauty – and most importantly, there’s as yet no indication of the weeds and chaos that will take over the garden (and my psyche) in the weeks to come. Time to gear up for another season of gardening!